Peter Boghossian’s Pretend Arguments

comments form first comment
This entry is part 3 of 15 in the series Peter Boghossian


I’m not sure how best to characterize Peter Boghossian’s methods for undermining the word faith. He says faith is pretending to know what you don’t know. What then is the correct word for acting as if you’re contesting a certain position, when in reality you’re only teasing around with it, at its easiest and most inconsequential fringes? How about this: Peter Boghossian’s pretend arguments.

That may seem like a harsh assessment to make of a philosophy professor, or maybe even a little too cute, and not quite professional. I think, though, that when you find out what he’s trying to put forth, you’ll agree it’s hard to take his arguments more seriously than that.

“Five of the only ten things that can be said for faith”

I’ll start with his May 6 lecture to humanists of Greater Portland, which he mentioned more than once in his later podcasts, indicating he seems to think it important — definitive, even — in some respects.

In that lecture he said that faith is pretending, in fact, “it’s definitive of faith that it’s pretending.” How does he support that assertion? He tells the group there that “there are only ten things that can be said for faith.” 

Now, based on the way he introduces the talk, it could be that he’s focusing specifically on the linkage of faith and morality, which “is a potent cultural force, and we must terminate it.” (He speaks elsewhere of how his anti-faith campaign is the focus of his entire life.) But in the relevant portion (around 4:00) he seems to step away from that specific focus to speak about faith in more general terms, as he returns to his “only ten things that can be said for faith.” He details five of them:

  1. “Life has no meaning without faith.”
  2. “I’m having a crisis of faith.”
  3. “Science can’t explain quantum mechanics.”
  4. “I don’t have enough faith to be an atheist.”
  5. “My faith is true for me.”

Really now: are these the top five (or five of the top ten) things to be said for faith? No. This list is not weak; it is worse than that. Let me deal with each of these items in turn.

Five of the Most Serious Straw-Man Fallacies Of All Time

1. “Life has no meaning without faith.” I’m sure one could find many examples of this being said, but with respect to Christianity, it always comes packaged together with the explicit or implicit meaning, “… faith that is connected to a real God.” For careful thinkers, the true statement might be, My life has no meaning without my relational connection to God through faith.” Or in certain philosophical discussions, “Life has no objective meaning unless there’s a God to give it meaning.”

Granted, unbelievers have vigorously contested both of those. But the key point is this: the version Boghossian offers isn’t one that apologists offer as grounding for the truth of Christianity. He’s debunking a non-argument.

2. “I’m having a crisis of faith.” Let’s deal with this one the easy way: it just doesn’t belong on a list of “the only ten things that can be said for faith.” It isn’t even something that can be said for faith! Who would think that it was? How did he think that belonged here? It’s an astonishing statement to include on a list like this.

3. “Science can’t explain quantum mechanics.”  I’ve been in working in Christian apologetics a long time, and I’ve never heard that raised as a point in favor of faith. Boghossian told this lecture audience he couldn’t help laughing when he wrote that one down. What or whom was he laughing at?

4. “I don’t have enough faith to be an atheist.” Now that’s a valid objection with respect to atheism, but only in context of an explanation of what one means by it. My friend Frank Turek wrote a book and delivers talks by that name. But Boghossian uses it instead to run a riff on apologists’ “pretending.” Then he explains that most atheists don’t claim to know there’s no God, only that there’s not enough evidence to conclude there is a God. It’s a fair point, but it’s also irrelevant to the content of Frank’s message. It’s a red herring, in that context.

5. My faith is true for me. Good point: this is something people say about faith, and it is totally invalid. Does Boghossian know, however,  just how much effort Frank Turek (to name just one example!) and other apologists and preachers have put into trying to conquer that very misconception? Here Boghossian has named a valid target for ridicule: but it’s one that most Christian apologists I know of would also place high on their list of false beliefs. It’s hard for him to use something like this as proof that Christianity is wrong, when on this point we’re in total agreement.

“The First Two Miracles I’d Debunk, To Show That Miracle Claims Don’t Support Faith”

So what, then, can we say in summary of all this? I’m sorry, but it’s a bit too soon yet to say. We need to turn to his PSU talk, wherein he speaks (after about 29:00) of “three core reasons for why one believes one’s faith tradition is true…. Reason number one: Miracles. We’re going to examine a few miracles.”

Let me pause and ask you to consider which faith-truth-convincing miracles he might want to examine and debunk. The resurrection? Healings? Visions? No, none of these. Ladies and gentlemen, for the safety of your clothing, lower your drinks. The miracles he chooses to debunk, and thereby to destroy the faith-enhancing credibility of miracles, are:

  1. Transubstantiation: the substantial change of the Eucharist elements into the body and blood of Jesus, according to Catholic doctrine…. and
  2. Tongues, or glossolalia.

Or, Two More Ridiculous Straw-Man Fallacies

Now, it could be that someone, somewhere has said that tongues constitute miraculous evidence for Christianity. I might have even heard such a thing myself, somewhere along the way. But I spend a lot of time reading arguments for and against Christianity, and I simply cannot remember the last time I heard tongues mentioned. It’s been decades, at least. No one offers up tongues as apologetical evidence for the miraculous. Or if they do, most of us know that it’s weak; so weak that we don’t ever put it forth. Never. Boghossian is debunking another non-argument here.

As for transubstantiation, that’s even worse. Dr. Boghossian has studied philosophy, so he’ll understand this language. The doctrine of transubstantiation states that the elements are changed in their substance, not in their accidents. Their accidents remain as they were before. If you don’t understand substance and accidents, don’t worry: just realize first that the professor does (or should) understand; and second, that because of this philosophical aspect of the doctrine, no one thinks transubstantiation demonstrates a miracle. Catholics believe there is a miracle going on there, but they do not think there’s a miracle demonstrated there.

So in attacking the apologetic value of transubstantiation and tongues, Boghossian has debunked nothing whatsoever.

It’s time to tie all this together. There are libraries filled with strong arguments for Christianity. But Boghossian has taken aim at — how shall I say this? — not weak arguments, but statements (or versions thereof) that no one even thinks of as arguments.

He obviously has great fun tearing down faith this way. Fine: whatever entertains him, I don’t care. But he’s supposed to be an educator. Throughout his many interviews and lectures I’ve listened to, he emphasizes that his real goal in life is to promote serious critical thinking.

And this is his example of serious critical thinking: putting up the weakest possible straw men and knocking them down.

Peter Boghossian’s Pretend Arguments

His performance in both these lectures amounts to a parade of fallacies.

Yet if you watch these two lectures through to the end, you’ll find that the audiences eat it up; or many of the people do, at any rate. They’re being taught by a distinguished looking university professor. They like what they’re hearing. It agrees with their prejudices. And — in the role of an educator, mind you — he’s leading them on with obviously fallacious thinking. There’s something seriously wrong about that tactic.

He says faith is pretending to know what you don’t know. I ask again, what is the correct word for pretending to do battle against a worldview, when in reality you’re only teasing around with it, at its easiest and most utterly irrelevant corners? What’s the word for carrying on with that kind of pretense when you’re old enough to know better?

Series Navigation (Peter Boghossian):<<< Peter Boghossian’s Atheistic MissionPeter Boghossian Pretends To Know What He Doesn’t Know >>>
top of page comments form

123 Responses to “ Peter Boghossian’s Pretend Arguments ”

  1. Tom: You know I struck out. Why don’t you give it a shot, reach out to Peter, see if you can get a genuine dialogue going? Somebody, some day, is going to have to tell him that he’s arguing in public as a professional academic philosopher, against a non-existent religion. Hard news to break, but somebody probably ought to do it.

  2. It would be great to hear you have a discussion with him, David. Perhaps on a show like Unbelievable?

  3. And I was taken to task for calling Boghossian’s pretend definition of faith a strawman. Turns out I my real problem wasn’t going too far but not going far enough.

  4. Is he not even aware of the challenge Paul sets forth in 1 Corinthians 15? That the resurrection of Jesus Christ is the cornerstone of Christianity – I wonder why he doesn’t tackle this?

  5. Strawman. Not even good strawman.

    It was hard to pick the worst one, but perhaps it was #3, that science can’t explain quantum mechanics.

    If that was the argument offered I’m… speachless.. But I’ve never seen it argued by a Christian. Ironically I’ve seen it offered by a new age atheist. But that person would be just as vitriolic about faith as PB would.

    In fact I’ve regularly seen atheist claim that quantum mechanics means that the universe could come from nothing… But as soon as I start asking about anything more than throw away lines, say, why a system in an eigenstate of the Hamiltonian isn’t totally inert, as standard quantum mechanics says it should be, they get all annoyed. Many times people offering this line dont understand the first thing about what they are talking about. What would PB say about large numbers of his own movement then?

    Quantum mechanics is seen as a big sheet to hide behind, but it’s mostly used by atheists in my experience, not Christians.

    That said, I have seen some arguments, such as that it is impossible to square with quantum mechanics is a locally realistic hidden variable theory. In other words, exactly the way many materialists view it. The violation of a Bell inequality proves so, and that was demonstrated in experiment by Aspect in the early 1980s.

    I’ve also seen Stephen Barr argue, quite rightly, that epistemic views of quantum mechanics make belief in God seem natural. I, for what it’s worth, agree.

    What strikes me as ironic here, is that both the Christian views are in line with line scientific orthodoxy, views by people like Polkinghorne, Stephen Barr, Ross MacKenzie, Andrew Briggs, or for that matter Max Planck himself. On the other hand, most atheist views I hear in religious debate are often, being charitable, “highly speculative”.

    Point #5 is similar. Generally Christians aren’t postmodernist, and pretty much every church I’ve ever been to has been opposed to postmodern views of truth. It’s the “for me” part which is ridiculous, and that’s the part straight from atheist thinkers.

    Again, strawman… Attacking something atheists would generally say, not Christians.

  6. I think the issue with QM is whether or not it is a final theory as it is currently formulated, or if there is still yet something beneath it, such as Nottale’s Scale Relativity ( http://www.physicsforums.com/showthread.php?t=235170 and
    http://luth.obspm.fr/~luthier/nottale/arIJMP2.pdf – for the physicists/mathematicians amongst us )

    What that has to do with faith, and the Christian faith in particular, or how it is an argument for or against faith, I’d like to hear that one.

  7. Yeah, exactly. I’m just an ordinary guy, but I love both science (in particular quantum information) and also Christianity. I go looking for what people write in this about the two, and I’ve never seen that.

    I guess he might be talking about some teenage YouTube video.

  8. David Marshall is certainly correct in encouraging engagement with Mr. Boghossian. However, I would doubt that Mr. Boghossian is very interested. We have seen over and over the public figures in the New Atheism being much more interested in demeaning religious belief than actually engaging with it’s claims on an intellectual basis. After all it’s the stated objective and strategy of the New Atheism to use ridicule as a central tool against religion. We saw this in the debate with Luke Muehlhauser and we’ve heard it from such luminaries as Richard Dawkins. I believe Mr. Boghossian is just the latest flavor of the month.

  9. You must admit that there are aspects of most religions that are easy to ridicule: talking animals, winged horses, transubstantiation, e-meters, golden plates etc?

    I doubt that Boghossian is going after you guys. I would expect that he’s much more interested in speaking to the masses of people who would claim to have faith as if it were a good thing – made them seem more moral or whatever – but haven’t really thought much about it at all.

  10. “Going after”? What does that mean? Sounds to me, per this thread and thet previous one, like he’s going after them to make it harder for them to think clearly and well about it.

    Some educator.

  11. As a Christian for many years, Boghossian’s definition of “Faith” was exactly the way I would have defined it. When I would question something that my parents could not answer they would shake their head and say “Don’t try to outsmart god, you just have to have faith” ie believe in something I don’t have any other proof than a Holy Book and Fuzzy Feelings.

    Some Christians will point there fingers and say ‘Well you were following the wrong Jesus” “That’s not Christianity”

    Theist in-fighting can be so interesting. For a religion that believes “Only god can judge me”, there sure is a lot of Judging going on

    I think Boghossian is trying to get people to think outside the bible, the Q’ran, the Book or Mormon…Any document that tries to convince a person they are broken and need some supernatural intervention to be cured.

  12. Theist in-fighting can be so interesting. For a religion that believes “Only god can judge me”, there sure is a lot of Judging going on

    Don’t tell me that this surprises you? I hope in your Christian upbringing you were taught that Christianity is a religion that believes Christians continue to sin and get things wrong.

    And the type of judging in the context you are using it is a good thing.

  13. Tom,

    I’m glad I was raised the way I was. It’s given me a great perspective in way I could never have imagined. The reality is that my “Faith” experience is similar to many others. This is the reason so many churches are losing people. The internet let’s people see for themselves. What the churches are doing now won’t really matter at this point. I don’t think we will ever get to a point where religion is completely replaced, but I feel it’s power will be marginalized. Look at this conversation for example. How long ago would this conversation been deemed heresy?

  14. Huh????

    Never, as far as I know. It wouldn’t have happened in the Middle Ages: a Peter Boghossian would have been laughed out of school for his incredibly irrational mode of handling argument. That is to say, in any venue where an argument like this could have had opportunity to arise, they probably knew their logic better than people do today.

    Now let me say this quickly: I’m not an historian of the Middle Ages. I’ve read rather more than the average person on it, but I really have no place to say what I just said with any authority. It’s my impression.

    Let me say this also: I doubt you have anything more to go for your opinion than that.

    Are you a skeptic like David?

  15. @victoria, yes. Interesting paper: the foundation of quantum mechanics can be put on information theoretic grounds.

    @tommy
    I’m just an ordinary Christian too, and I’ve only ever seen atheists offer PBs definition. For most people it is just a synonym for following and trusting God, even when the going got hard.

    When I had issues, I went away and looked at what Christians of the past had to say, and to my surprise they had thought about the same questions and often had very good answers.

    I mean seriously. Look at PBs points here. Each and every one is an obvious straw man. I think even the most outspoken atheist can see that.

  16. We have seen over and over the public figures in the New Atheism being much more interested in demeaning religious belief than actually engaging with it’s claims on an intellectual basis.

    This is true. Last night I attended a debate between William Lane Craig and Lawrence Krauss.

    From the start Krauss was rude and aggressive. In his opening statement he accused Craig of being a liar. He rarely stuck to the point, and preferred to use one-liners to avoid engaging on any issues. Craig, by contrast, was polite and gracious.

  17. I think one of the things that Dr. Boghossian maybe doesn’t emphasise enough, in his excitement to rid people of beliefs that he believes are irrational, is that faith is actually vital to the functioning of our society. Faith, that is, in people.

    I have faith in my wife: I am faithful to her, loyal to her and I will defend her if anyone speaks ill of her. This isn’t “blind faith” mind you – I have reason to believe that she is a good person, and lots of evidence to back it up – but it is faith.

    If someone came to me and said “I saw your wife steal a handbag from the store” I would tell them they were wrong because I know my wife would never do that. Now of course, I don’t actually know that she didn’t steal the bag – I wasn’t there to personally witness her paying for it – but I have faith in her.

    Suppose this accuser presents some evidence, such as a security tag that hadn’t been removed from the bag. To him this is conclusive proof, but to me it is obvious that the sales assistant forgot to remove the security tag – after all, this does happen from time to time, and I have the utmost faith that my wife would never steal.

    Am I being overconfident? Possibly. Am I displaying confirmation bias? Quite probably. Am I pretending to know something I don’t know? I suppose I am. But is my faith a bad thing? Should I instead follow Dr. Boghossian’s method of reasoning and dispassionately weigh up the evidence to determine whether or not my wife is a thief? Should I cross-examine her and challenge her account of the transaction, trying to find a discrepancy? Of course I shouldn’t. If I followed that approach, by the time I finished my rational investigation and discovered that she did not, in fact, steal the bag, I might well find that she wasn’t my wife anymore either!

    Having faith in my wife is a rational thing to do: if I have faith in her and defend her, whether or not I am defending the actual truth, my relationship with her will remain strong and faithful. If I undertake a rational search and discover the actual truth, whether the truth is that she stole the bag or not, my relationship will be destroyed. My relationship with my wife is in this case, as in most cases, is more valuable to me than the truth. Therefore, having faith – pretending to know what I don’t know – is an entirely rational thing to do.

    We need faith. Our interpersonal relationships depend on it. Without it we would be constantly suspicious of each other and wouldn’t be able to function as a society. People deserve faith. And I would be astounded if Dr. Boghossian were to claim otherwise.

    People deserve faith. But beliefs don’t deserve faith.

    In the past people believed that Earth is flat. They had reason to believe this: Earth looks flat; it feels flat; it has an “up” and a “down”; it’s obvious, really. Unfortunately, people didn’t just believe that Earth is flat and then leave it at that: they had faith in their belief. When evidence was presented that contradicted their belief, they defended that belief. You could say it was instinct really: faith, they had learned, is a good thing, without which society would crumble. It felt natural to defend their belief, to be faithful to it and to protect it from the accusations made against it – even when those accusations were accompanied by hard evidence – just as they would defend a loved one.

    This is the type of faith that Dr Boghossian is trying to rid the world of: faith in beliefs. And on this I support him.

    Beliefs don’t deserve our faith, our respect or our loyalty. They should not be defended against new evidence: they should be cross-examined, challenged, tested, and ruthlessly interrogated to find any discrepancies, anything that doesn’t quite add up. We should be constantly suspicious of our beliefs – particularly the ones that we rely upon most heavily – and we should be ready to betray them mercilessly at the very instant the weight of evidence shifts against them. If we are not prepared to be so unfaithful to our beliefs, then we will have blocked our path to the truth.

    Our beliefs won’t be faithful to us – we do not have a relationship with our beliefs – so it is not rational to be faithful to them. If I defend a belief against new evidence, it will not thank me for doing so. If my belief was true before I defended it, then my defence did not change that, but if my belief was false, then my defence of it may have prevented me from discovering this fact. Therefore, having faith in my beliefs is not rational.

    Having faith in people is rational. Having faith in beliefs is irrational. The question then becomes: is God a person or a belief?

  18. You are using faith as a synonym for trust.

    Relationships are built on trust, but they are not built on pretending to know things that you don’t know. You can have high trust in your beliefs about the other person, while still accepting that there is a possibility your beliefs are wrong.

    You don’t need to pretend to know things in order to show your support for someone.

    You can strongly state your belief that someone wouldn’t do something – that you trust them and that it would be completely out of character – but you don’t need to say “I know she didn’t” because that is pretending to know something you don’t know.

    Saying you know may seem to signal the strength of your conviction in the belief, but it is still pretending. And it’s unnecessary. Perhaps it doesn’t matter, in this case, but if you keep pretending to know things that you don’t know you may start to believe in your own charade.

  19. “You are using faith as a synonym for trust.”

    Well, of course!

    Let’s look at what it meant in the source documents, per Louw-Nida:

    LN 31.85
    31.85 πιστεύωb; πίστιςb, εως f: to believe to the extent of complete trust and reliance—‘to believe in, to have confidence in, to have faith in, to trust, faith, trust.’ πιστεύωb: ὃς δ’ ἂν σκανδαλίσῃ ἕνα τῶν μικρῶν τούτων τῶν πιστευόντων εἰς ἐμέ ‘if anyone should cause one of these little ones to turn away from his faith in me’ Mt 18:6; ἐπίστευσεν δὲ Ἀβραὰμ τῷ θεῷ ‘Abraham trusted in God’ Ro 4:3; ὁ πιστεύων ἐπ’ αὐτῷ οὐ μὴ καταισχυνθῇ ‘whoever believes in him will not be disappointed’ 1 Pe 2:6. πίστιςb: ἔχετε πίστιν θεοῦ ‘you have faith in God’ Mk 11:22; ἤκουσεν αὐτοῦ περὶ τῆς εἰς Χριστὸν Ἰησοῦν πίστεως ‘he listened to him (as he talked) about faith in Christ Jesus’ Ac 24:24; ὁ δὲ δίκαιος ἐκ πίστεως ζήσεται ‘he who is righteous because of his faith shall live’ Ro 1:17; ἀκούσαντες τὴν πίστιν ὑμῶν ἐν Χριστῷ Ἰησοῦ ‘we heard about your faith in Christ Jesus’ Col 1:4. In rendering πιστεύωb and πίστιςb it would be wrong to select a term which would mean merely ‘reliance’ or ‘dependency’ or even ‘confidence,’ for there should also be a significant measure of ‘belief,’ since real trust, confidence, and reliance can only be placed in someone who is believed to have the qualities attributed to such a person.

  20. It’s a straw man argument (based on equivocation) because Boghossian does not define faith to mean trust. You may not like his definition, but that’s not the point.

    Having faith in people is rational. Having faith in beliefs is irrational. The question then becomes: is God a person or a belief?

    In Boghossian’s language this is translated as follows:

    Pretending to know things about people is rational. Pretending to know things about beliefs is irrational.

    Now can you see the problem?

    In addition, there is another obvious issue with that line of reasoning due to the unfortunate fact that what we believe about people are also beliefs.

  21. I agree that “Science can’t explain quantum mechanics” is not a general argument about faith, particularly Christian faith. It seems like he’s taking the Einstein bit about “God doesn’t play dice with the universe” and wildly inflating it, both in what it meant and who it applies to. I guess he intended to target ‘new age’ types with that one.

    On the other hand, there’s a lot of “[Naturalistic, that is to say non-supernatural] Science can’t explain _______.” in religious apologetics. Here on this site, I’ve run into that regarding consciousness, the origin and development of life, and reports of miraculous healing. Had he tackled that far more general trope, it would have been way more interesting and effective.

  22. @Ray Ingles:

    On the other hand, there’s a lot of “[Naturalistic, that is to say non-supernatural] Science can’t explain _______.” in religious apologetics. Here on this site, I’ve run into that regarding consciousness, the origin and development of life, and reports of miraculous healing. Had he tackled that far more general trope, it would have been way more interesting and effective.

    And if David P’s brand of sillyness was not enough, here comes Ray Ingles adding his own.

    I surely hope that the dismal intellectual quality of skeptic and atheistic comments on display in this blog is not representative of the group at large. Sheesh.

  23. But, G. Rodrigues, if you won’t actually correct my mistakes, actually point out where I’m wrong, how can I learn? I suppose calling me ‘silly’ and ‘dismal’ might make you feel better, but it’s fairly limited as a didactic tool.

  24. Small point, Ray, but I don’t think that G. Rodrigues called you silly or dismal, just your comments. Whether this is true remains a matter of opinion.

  25. Ray,

    As far as your “Science can’t explain _______.” lets look at a couple you mentioned. The origin of life. (The development of life is a separate question if you are referring to evolution.) Science has been exploring the origin of life since Miller/Uray in 1953. As of today, 60 years later, it’s true that science hasn’t explained the origin of life or even developed the most basic hypothetical. Can we now say science can’t explain the origin of life? What do you think? As far as science can’t explain miracles that’s close to one of Boghossian’s “arguments”. No one, theist or atheist, would expect science to do that. If it could they wouldn’t be miracles.

  26. In Boghossian’s language this is translated as follows:

    Pretending to know things about people is rational. Pretending to know things about beliefs is irrational.

    Now can you see the problem?

    In addition, there is another obvious issue with that line of reasoning due to the unfortunate fact that what we believe about people are also beliefs.

    The point I was trying to convey (and I probably didn’t express it as well as I would have liked) was that there is a very important difference between faith in people (or faith in beliefs about people) and faith in non-people-related beliefs: people are touchy-feely and don’t like it when you interrogate them and question them, so from a social cohesion perspective it’s usually a good idea to give them the benefit of the doubt (an obvious exception being when you’re a member of a jury); non-people-related things are not touchy-feely and you shouldn’t just give them the benefit of the doubt. If I have understood Dr Boghossian correctly, his mission is to get people to treat beliefs differently to the way they treat people, which at the moment not many people do.

    How do you treat your beliefs? When was the last time you seriously interrogated one of your beliefs? I’m not talking about just looking around to make sure there’s some evidence to support it, I’m talking about wiping the slate clean and starting from scratch with only the evidence you can observe now and the tests that you can actually perform. It’s not enough just to say “I admit that I might be wrong” – saying so means nothing unless you also specify the actual observable evidence that would cause you to change your belief and then genuinely looking to try and find that evidence.

  27. I dunno. I think that science could in principle explain a miracle. For example, a while back somebody proposed a naturalistic model for the parting of the sea. (Though I actually think they might have been a Christian.) It involved strong winds interacting with a fairly narrow channel that forced the waves back. (Details are sketchy and I don’t have time to look for it.)

    Now if we assume for a moment that this is possible then you have a scientific explanation that the naturalist will feel is sufficient to explain away an apparent miracle. However, the theist can, I think, justifiably go beyond the science and ask why this happened at all. With the conclusion that God can, and perhaps did, manipulate natural forces to his own ends. In a similar vein, I guess that part of the fascination with neuroscience that is seen amongst some sceptics is down to its ability to readily provide a “god of the brain” explanation for all manner of personal experiences. I wonder if it’s not a powerful argument against theism that is also open to overuse and therefore abuse.

  28. @David P:

    Are you having a bad day G. Rodrigues?

    Here is what I would respond if I were *really* having a *really* bad day: that a bad day is but straw in comparison to a silliness-filled span of life.

    And please, please, spare me your passive-aggressive rubbish. Save it for someone that has more tolerance for it than I have.

    @Ray Ingles:

    I suppose calling me ‘silly’ and ‘dismal’ might make you feel better, but it’s fairly limited as a didactic tool.

    First, I did not called you “silly” or “dismal”. Second, you are incorrect as to the alleged limited didactic value of punishing students — depends on the student. Third, whatever made you think I was trying to be “didactic”? I would presume it is pretty obvious that I was not; after all, I am not your teacher and it would be highly presumptuous of me to play one. Fourth, and just in case you miss it, I am being deliberate in taking the above literally, at face value and with no trace of irony. Fifth, rhetorical question: did it “make you feel better” posting what you did?

    @Billy Squibs:

    Now if we assume for a moment that this is possible then you have a scientific explanation that the naturalist will feel is sufficient to explain away an apparent miracle. However, the theist can, I think, justifiably go beyond the science and ask why this happened at all.

    This is, in rough terms, the classical distinction between miracles “above nature” and “beside nature”; the latter being closer to what you mention. As you point out, God could have futzed things (say, synch very precisely the initial conditions at the Big Bang or whatever) such that at the precise time needed, a given effect is produced. Furthermore, the effect is further “synchronized” with its “production” from a freely willed human act, the word of Moses when parting the Red Sea say. It can still be considered a miracle due to the intervention of God, the lack of proportion between the effect and the means, the intended goals, etc.

    nota bene: classically, although theologians spoke of miracles “contrary to nature”, they did not conceive them as “violations” of the “laws of nature”; this is a relatively modern development, relying heavily as it does, on a Humean account of the latter.

  29. @David
    Why don’t you explain from your vast knowledge of philosophy and metaphysics just how G. Rodrigues (who is both a professional mathematician and philosopher) is misguided?

  30. @Victoria:

    Why don’t you explain from your vast knowledge of philosophy and metaphysics just how G. Rodrigues (who is both a professional mathematician and philosopher) is misguided?

    Just a small correction: professional mathematician, yes, philosopher, no. The latter would be appropriate for Holopupenko.

  31. @G. Rodrigues 🙂
    Okay, so you don’t get paid to be a philosopher, but you are one nonetheless 🙂

    But, are you waiting with bated breath for David’s attempt?

  32. G. Rodrigues –

    First, I did not called you “silly” or “dismal”.

    Fair enough. But if you want better comments from me, I’ll need a bit more than derision about them.

    you are incorrect as to the alleged limited didactic value of punishing students

    Simply saying “Wrong!” without any indication of why they are wrong is, indeed, of limited didactic value. Consider me a particularly dim student if you must, the kind that needs things spelled out for them. If you’re right, I’ll be grateful, and if you’re wrong, I assure you that my feelings are quite safe from your derision.

    rhetorical question: did it “make you feel better” posting what you did?

    Well, it was in the pursuit of the goal of understanding your objections, so in that sense it did. If you’re not intending on teaching me anything, though – if you don’t intend any kind of productive conversation – I guess I just have to take your post as a whining complaint. And the value of that stuff is even more limited than a simple ‘thumbs down’.

    I’ll set my future expectations accordingly.

  33. @Victoria:

    But, are you waiting with bated breath for David’s attempt?

    I suspect he will say that he never pretended to know. That it is just his opinion. That he is not interested in the evidence because he has more interesting things to consider. The he wants predictive models. Or something. I sincerely wish that my suspicion turns out wrong.

    note: and actually, professional mathematician is *also* over-reaching, as while I do research mathematics within a research institution, my position (quite an originality) is not exactly what one thinks of when one thinks of “professional”.

  34. BillT –

    As of today, 60 years later, it’s true that science hasn’t explained the origin of life or even developed the most basic hypothetical. Can we now say science can’t explain the origin of life? What do you think?

    It’s a very big jump from “hasn’t” to “can’t”. And it’s been wrong before. I think there are still plenty of interesting hypotheses left to explore when it comes to the origin of life.

    Basically, the “science hasn’t explained it, therefore science can’t explain it, therefore it has a supernatural explanation” trope is awfully common, and worth addressing. Kinda wish Boghossian had done so.

  35. There is some truth to your last paragraph, Ray. However, it seems to me to be prejudicial to deny – as you appear to be doing – the possibility that God might be a plausible explanation for X.

    While Christians have been guilty of playing the “God of the gaps” card, I’ve known more than one atheist (the type usually besotted with science) who happily plays the “science of the gap” cards in the face of our collective ignorance.

  36. David P, while I appreciate that G. Rodrigues has spoken harshly to you and that some manner of comeback is satisfying your above response is vacuous.

  37. Ray,

    I can accept that in principal. However, can you name another scientific field that has accomplished so little in so much time. I mean they sequenced the entire human genome and the origin of life folks don’t even have a legitimate starting point. The idea that it even has a scientific name is getting to be a joke at this point.

  38. @Billy Squibs
    That’s exactly the point I was trying to make. If G. Rodrigues wants to argue his case so that we can all learn from the discussion that would be great. If he just wants to make snide comments without providing any explanation it seems a wasted opportunity for everyone.

    Anyway, I’ve spent a lot of time on this site in the past week or two. It has been interesting and useful for me but I feel like I’m getting diminishing returns now, so I think I’m going to say “goodbye” for now.

    Thanks for the conversations where we did actually have conversations and I sincerely appreciate Tom and other Thinking Christian’s courage and openness to engage with outsiders. Though I’m not sure how productive it is.

  39. @David P:

    Why on earth would I need to explain further? Surely a condescending assertion is enough to settle the matter? I mean, I am not Rodrigues’ teacher and it would be highly presumptuous of me to play one, right?

    Touché.

    But it was as I predicted; you have absolutely nothing but the bluff of a poseur. And condescension? Really? You speak of condescension when here you ask and I quote:

    Is it possible do you think for someone outside to help or does it have to be driven from inside? I’m an atheist and would like to help people.

    Now, what kind of “help” are you asking? Let us quote the words of the person whom you are asking for help:

    Christians are vicious, and they will use words to kill, just like their mythical god-man said. If you haven’t read psychologists who point out that religion is infantile, then you haven’t read the literature that I have read. I’m not giving you a reading list, because your mind is already made up, and you would only dismiss it as unworthy of your high learning. I don’t have any more time now for this discussion, but I think you have proven my point, for you are certainly an example of all that I have said about Christianity.

    This is right down *insulting*; and yet you ask for “help” for a kind of “psychological deprogramming”. And you have the gall to speak of condescension? You speak of condescension, when you drag down a thread for hundreds of posts just to blurt out:

    I’ve explained previously why the detailed contents of the source documents are irrelevant to me. I have already rejected them on the grounds of “insufficient evidence” based on their supernatural claims and my assessment of the lack of ability of people of that era to gather evidence to a suitable level of reliability to back up the claims.

    Really, who are you trying to fool? It certainly is not me.

    You really should, for your own sake, take a hard long look at yourself.

    But enough of this; I mention it in the hopes that will wake you from your dogmatic slumber, but it certainly is disagreeable. If after looking hard at yourself, you still want to discuss the evidence like grown men do, every Christian here is up for the challenge (although each in its own preferred field of knowledge).

  40. Ray, would you please show is one source who is credible among thought-leading Christians and who says, “science hasn’t explained it, therefore science can’t explain it, therefore it has a supernatural explanation”?

    I’m serious.

    Just one.

    Be cautious: there’s a difference between that and “philosophical reflection open naturalism gives us reason to believe that naturalism provides no possible explanation in principle, therefore naturalism probably can’t explain it.”

    There’s also a difference between that and “what we’re learning by way of scientific research demonstrates that a naturalistic explanation is becoming progressively more difficult to imagine.”

    And there’s also a difference between that and “what we’re learning by way of scientific research is providing additional reason to wonder how a naturalistic explanation is possible, even in principle.”

    I don’t think you’ll find any thought-leaders among Christians saying what you attributed to us here.

    I hope you can at least recognize the difference between those claims.

    In other words, I am quite sure you are wrong. Again.

  41. YATom.

    I’ll leave aside whether a distinction between “faith in people” and “faith in beliefs” is valid, and instead note that “faith in God” is “faith in a person”, with all that entails.

    God is knowable, God has character, and God finds us (at least) rude when we treat him as unknowable or unreliable.

    The Scriptures claim and argue that the fundamental problem with knowing God isn’t lack of evidence or revelation, but our unwillingness to accept the evidence on God’s terms because it makes us look bad.

  42. I think it’s funny that when someone offers a definition of faith, comparing it to their wives, David P (and atheists following PB) disagree.

    That’s the what Luther says. That’s very similar to what’s said in the Bible.

    The person offering that definition of religious faith is being faithful to the definition used for centuries.

    I think the agenda is transparent and dishonest. Look at what he just tweeted about Faith based programs. Originally I thought PB was interesting. The more I learn, the more he comes off as purposefully manipulative. I’m unfollowing.

  43. Billy Squibs –

    However, it seems to me to be prejudicial to deny – as you appear to be doing – the possibility that God might be a plausible explanation for X.

    I don’t deny the possibility. I have opinions on what the best bet for solving unsolved problems will turn out to be, of course, but that’s not the same as claiming to know. (Of course, this is my favorite quote regarding opinions: “You are not entitled to an opinion. An opinion is what you have when you don’t have any facts. When you have the facts, you don’t need an opinion.” – David Gerrold)

    The interesting thing is that the set of ‘things we can account for without recourse to the supernatural’ has been growing monotonically since we started keeping records. It’s never gone down. I know of no case where something that people generally agreed was a simple, non-supernatural phenomenon later became regarded as a ‘contrary to nature miracle’, or even ‘beside nature’ (to use G. Rodrigues’ terminology, however much that might pain him). But I can point out lots of cases of the opposite.

    So, while that doesn’t by any means prove that we’ll eventually have non-supernatural accounts for everything, it does incline me to think that’s the most probable outcome.

    A side point – in the early 1700s, before Benjamin Franklin et. al. got a handle on what lightning actually is, was it reasonable to say that God (or Thor, or the Thunderbirds, or Zeus, or Seth, or what have you) caused lightning? No, the proper response to “What causes lighting?” was “Darn if I, or anyone else, knows.”

    Anyone could certainly have ventured an opinion that lightning was caused by gods or other supernatural creatures, or that it was some natural phenomenon that might eventually be understood. But then, I just quoted David Gerrold about opinions. 🙂

  44. BilT –

    However, can you name another scientific field that has accomplished so little in so much time.

    How many thousands of years did it take before people had any decent understanding of their own bodies? It wasn’t accepted that blood circulates for many centuries, and following Aristotle people thought the brain was used to cool the heart. How many thousands of years was it before we had a decent understanding of combustion, something we’ve been using in practical applications for a hundred thousand years or so?

    We’ve explored the practical applications of quantum mechanics since at least the 1920s, but nobody has a real understanding of the underlying mechanisms. The existence and structure of DNA wasn’t uncovered until the 1950s, so QM’s had longer to go.

    I mean they sequenced the entire human genome and the origin of life folks don’t even have a legitimate starting point.

    Well, you can call the hypotheses we have ‘illegitimate’ if you like, and I can disagree. The RNA World hypothesis has a lot going for it – can you explain why to this day transcription is so heavily RNA-dependent? (It’s not just messenger-RNA, the actual ‘reading off’ of the DNA is done byribozymes (RNA enzymes), and the construction of the protein is done by a ribosome.) We keep finding new factors and considerations that make large organic molecules more likely.

    Of course, what we have now are indeed hypotheses, not theories. Lots of testing needs to be done, and it’s going to take time. I certainly wouldn’t teach anything about abiogenesis at the undergraduate level, ’cause it’s not cooked yet. (In that sense, it’s like Intelligent Design – it could conceivably have something to it, but actual research needs to be done to make that happen. It’s not clear that ID proponents are actually doing that, though.)

  45. So what about the miracles attributed to Jesus in the NT, then?

    Christians don’t believe in a magical world where the supernatural intrudes willy-nilly or without rhyme or reason. The Biblical view is that the physical universe is created by God in such a way as to be ordered and regular (those properties and dynamics of space-time and matter/energy). The universe is ordered and rationally comprehensible because God sustains it to be so (part of His immanence in Creation). In fact, the Biblical doctrine of Creation demythologizes nature – Nature is a created system – there are no gods behind various phenomena, only the one Creator God who sustains it by His general providence. God doesn’t have to be the immediate cause of any natural phenomena. That many of the OT Psalms talk about God as causing various phenomena speaks to His sovereignty and ultimate control over His Creation – God designed (the laws of physics that make ) lightning, and every other process that can be described by the ‘laws of physics’.

    Ray, you are way behind the times – bringing up things that no thoughtful Christian would hold to today – I completely agree that it is possible in principle to discover and describe the underlying properties and dynamics of natural phenomena. People in NT times did not have our sophisticated descriptions of natural phenomena, but they certainly knew enough about the way nature worked to recognize when something occurred in a way that nature does not normally work.

    We’ve had this discussion before – you haven’t changed a bit – still as recalcitrant and obtuse as ever.

  46. Tom Gilson –

    Ray, would you please show is one source who is credible among thought-leading Christians and who says, “science hasn’t explained it, therefore science can’t explain it, therefore it has a supernatural explanation”?

    I didn’t say that was the case. I said I’ve seen it “Here on this site”. E.g. in this very thread.

    In any case, so far as I understand, Boghossian was attacking (his version of) faith generally, not Christianity specifically. As I’ve already said, I guess Boghossian was aiming at people like Deepak Chopra with that particular ‘point #3’, not Christianity.

  47. Victoria –

    Christians don’t believe in a magical world where the supernatural intrudes willy-nilly or without rhyme or reason.

    Nor did I claim that. Can you name the three topics (and, note, only three) that I listed as widely regarded by theists as directly supernatural? (Hint: do you think Intelligent Design proponents are “thoughtful Christian[s]”?)

    (Note, also, that discussing the views of lightning in the early 1700s says nothing about the views of ‘thoughtful Christians’ on lightning today, nor did I ever claim it did. I brought it up as an analogy only, and I think I was pretty clear about that.)

  48. Ray,

    It’s incredibly dishonest that you linked my post as proof that on this site was proposed the idea that “…science hasn’t explained it, therefore science can’t explain it, therefore it has a supernatural explanation”? I specifically didn’t make that claim about origin of life studies, asked you your opinion and then agreed with your opinion when you gave it. Not only that but my general point clearly falls within the exceptions to that claim that Tom made in his post #50. Pretty sleazy, Ray.

  49. Here is a coded strand of DNA:

    (A=adenine, G=guanine, T=thymine & C=cytosine)

    CAAGTAGGGAGTTGATAAGGGATATAATCACAAGTAGTACAAGTATCA
    …GGGTCTAAAACTGGGAGTTGATAAGGGACAGCAAGATAA

    How did the code get there?

  50. Sorry if I misinterpreted, BillT, but that’s how I took your question – as a rhetorical way of saying science ‘can’t’.

    Especially in light of your followup. You did say, “The idea that it even has a scientific name is getting to be a joke at this point”, precisely because science hasn’t settled the origin of life yet.

    Since it’s not clear to me that you have a handle on what the actual hypotheses are when it comes to abiogenesis, I don’t see how you could advance something like (to use Tom’s terms) “what we’re learning by way of scientific research demonstrates that a naturalistic explanation is becoming progressively more difficult to imagine.”

  51. Let’s take a step back for a moment and consider what we are discussing:

    There is a component to living systems that is not present in non-living systems, namely complex specified information (codes, algorithms and programs – software that controls and directs how living systems function) + the infrastructure upon which that software executes – the ‘hardware’.

    The properties and dynamics of (STME – SpaceTime+Matter/Energy) make it possible for both the software and hardware to exist and function, but the big question is whether or not they can account for the origin of those things in the first place.

    Ultimately, it comes down to the type of universe we live in – a purely physical universe or a dual universe (with supernatural and physical components.

    Regardless of the type, lets write down:
    (a) for living systems
    Properties and Dynamics(STME) + time + stochastic processes + [ ??organizing principles] leads-to living systems (information processing systems).

    (b) for non-living systems
    Properties and Dynamics + time + (optional stochastic processes) leads-to simple or complex dynamically systems.
    So things like stars and galaxies and solar systems, planetary weather systems and their associated phenomena (like lightning).

    It is true that people once thought that both (a) and (b) required the direct input of the supernatural.

    Ray, your analogy really only addresses (b) – No question that scientific research has shown beyond a reasonable doubt that natural phenomena with the character of (b)-systems can be understood and described as I have written it.

    What has not yet been shown is that for (a)-systems, the term [?? organizing principles] is indeed a necessary consequence of purely natural, physical causes.

    If the type of universe we live in is a purely physical one, then necessarily the organizing principles have to be purely natural ones.
    If the type of universe we live in is a dual one, then we have:
    1. Deistic Universe – other than determining the laws of physics and kick-starting the formation of the universe, that supernatural component has no further interaction with the physical component, and we are back to natural organizing principles.
    2. Pantheism is basically the same as Naturalism : the organizing principles are inherent in the way the universe works.
    3. Theism 1: God designed the laws of physics, kicked off the creation of the universe in such a way that the organizing principles are again natural ones – He does not need to interact with the universe to control its development. He can interact with His Creation for other purposes (say to communicate with the intelligent life that develops).
    4. Theism II: God designed the laws of physics, created the universe, and directed the formation of living systems: i.e. the organizing principles that lead to information processing are external to the physical universe and require the interaction of a Mind. This God also interacts directly with us for other purposes.

    Both Theism I and Theism II are compatible with Biblical Christian Theism, and there are thoughtful Christians in both camps : Biologos for Theism I, ID Christians, ReasonsToBelieve (Old Earth Creationism) and even AnswersInGenesis ( Young Earth Creationism) for Theism II.

    If there is a supernatural component to the universe, then it does not necessarily follow that every event that has ever occurred or will occur is explainable only in terms of natural causes. You pay lip service to that idea, but you are an non-super-naturalist for sure.

  52. Victoria – I have yet to see a rigorous definition of “complex specified information”. Can anyone give me one? Ideally, one that’s measurable, like other forms of information?

    Here’s an example. Remember this article, that I pointed out a while back? Victoria, you might not have read it, you only made a few comments on that thread. But I urge you to read it now. It’s not very long, and it’s really cool.

    But here’s the question: do the recoded viruses contain (a) more, (b) less, or (c) exactly the same amount of “complex specified information”? Note, I will want an explanation and justification of any answer.

    (Note, two, that you’re only addressing one of the three topics I mentioned.)

  53. Victoria –

    If there is a supernatural component to the universe, then it does not necessarily follow that every event that has ever occurred or will occur is explainable only in terms of natural causes. You pay lip service to that idea, but you are an non-super-naturalist for sure.

    There’s two factors. One, a la Laplace, ‘I have had no need of that hypothesis’ (so far). Two, I’ve pointed out a lot of cases where things confidently declared to be supernatural turned out not to require a supernatural component. In my opinion, that trend will continue.

    But, e.g., a Saul of Tarsus moment would certainly change my mind.

  54. Tom:

    “Ray, would you please show is one source who is credible among thought-leading Christians and who says, “science hasn’t explained it, therefore science can’t explain it, therefore it has a supernatural explanation”?”

    Not sure about Christians, but I’ve seen a fair few atheists try to pull a similar move. “Well, your first cause argument might have passed muster in the middle ages, but nowadays quantum mechanics has proved that there’s no causation, har har aren’t Christians silly.”

  55. @Ray
    Thank you for the link. I’ll read it this weekend.

    Do you have a rigorous definition for the information content of the .NET runtime system? Or any piece of complex software?

    Can you reasonably question that a living cell uses a complex genetic code, stored in the DNA of its nucleus, interpreted and processed by complex subsystems to enable the cell to carry out its functions? That a cell is qualitatively different from a non-functional assembly of its constituents?

    If you want to say that you have no need for an intelligent agent in the case of information processing systems, including those that we find in living cells and organisms, fine, say so. Nothing in anything you have ever posted on this site leads me to think that you are anything other than a Metaphysical Naturalist. Why don’t you just simply say that this is your fundamental position and leave it at that?

  56. Ray,

    What a crock. When I said “I can accept that in principal.” what did you think that meant. Further, just because you can name some “hypotheses” (and they certainly deserve the “”) doesn’t mean they are indicative of any progress in the field whatsoever. And you had no reason to think I wasn’t aware of the “hypotheses” you mentioned as they weren’t part of the discussion.

    Oh boy! RNA world. How long has that old chestnut been making the rounds. For all your “new factors and considerations” it still hasn’t given the origin of life folks even a general direction for their studies. You can cling to it all you want but that’s way more about your faith than science and faith based on very few if any facts. Also, the non-progress of origin of life studies fits Tom’s paradigm precisely (and I referenced that as Tom’s point not mine).

  57. @62

    There is no good definition of SCI (ID protestations to the contrary) because SCI is promoted as a poor univocal example of “meaning,” when, in fact, meaning is mathematically ambiguous. Information is measurable because it’s an “amount” of information–NOT a content of information. Any good information theorist (starting with Shannon and ending with the acerbic Shallit) can tell you that. Information IS measurable; meaning IS NOT measurable. Information theory works at (among other things) reducing AMOUNTS of information lost or in recovering seemingly lost information without saying anything about what that information IS (i.e., what it means).

    Meaning is, crudely, what something IS to a rational agent. Meaning (through a definition) refers to the essence of the thing, i.e., WHAT IT IS, which is not measurable. A house is not known by the number and kinds of its bricks but by its form or formal cause (not to be confused with inFORMation, although they are related). The form is not the same thing as the essence: a human becomes the thing known essentially on the ontological level, formally on the logical level: the form cause is what “causes” a knowing agent to become the essence.

    The “information” of a house can be measured because it is material-based: there are 10,000 bricks, etc., and stored in computer memory. That very amount of material/matter can be reFORMed to produce, e.g., a church. Only a reductionist materialist fool would claim a house is a church simply based on the fact that the same amount of materials are used to construct each. (Do you see now, per Wesley Smith, why Peter Singer is reductionistically repugnant in flatlanding human children to pigglets?)

    Example on why meaning is mathematically ambiguous: I can employ sky-writing to draw the 100-m tall letters “RED” in the sky. I cam employ 6-point Arial-font letters to print on a page the Ukrainian word “червоне”. In each case, the meaning is exactly the same (gender designation notwithstanding for Ukrainian), while the information that is measurable in each case is vastly different.

    This is one of the many flaws of ID: Dembski tries to infer through the ill-formulated notion of CSI (which he’s correctly taken to the woodshed to by information theorists) meaning from information by means of a specific MES (Information Theory). That’s nonsense. He protests, of course, that he doesn’t… but that betrays inability to properly distinguish the two. Philosophically, Dembski IS a reductionist: he hold a univocal view of being as attested by his belief that DESIGN can be inferred DIRECTLY by the MESs. Design is NOT an object of the MESs–it is no more an object directly accessible to the MESs than the concept “life” is: biologists do NOT study “life”–they study “living things”!!! I can put a living thing on a table, I can NOT put “life” on a table.

  58. @Holopupenko
    Hello old friend 🙂 Nice to see that you are still around. I trust that all is well with you.

  59. Even if we can show on scientific grounds that a Theism II universe is not the case, you have not eliminated a Theism I universe, for that model still includes the case where God can, has and continues to, interact with us. Biblical Christian Theism, in particular, proclaims that He has done just that, ultimately in the person of Jesus of Nazareth, the Incarnate Son of God, who lived, was crucified, died, buried and was resurrected by the power of God. Christians today continue to claim a interaction with God through His indwelling Holy Spirit.

    You still have to show that the Christian explanation is not the inference to the best explanation for these historical and experiential claims.

  60. Right Holopupenko! It’s easy to confuse the map with the territory. Thanks for posting that message.

  61. Victoria:

    Thanks for the kind words… However, I’m bowing out of commenting for reasons I’ll explain to Tom… but I can’t resit a few more thoughts:

    The only possible argument for or against the existence of God (apart from Revelation which of course is the center piece of faith) is a philosophical one. No natural science—not even in principle—can directly achieve such an end… nor can any natural science prove or statistically undermine God’s existence. Sound philosophical arguments for the Existence of God are in hand, but they cannot be negated—only analogously-corroborated—by findings in the modern empirical sciences. For this reason, failed arguments like the Kalām are invariably caricatures of properly cosmological arguments because they fail to properly distinguish between per se and per accidens causal chains, and hence they temporalize essentially atemporal arguments… and I’ve found some (confirmed) egregious caricatures of Thomas’ Five Ways in Craig’s writings, not to mention his explicitly buying in to the univocity of being error.

    The so-called “demarcation problem” as proposed by Intelligent Design is a misunderstanding. The sciences are distinguished by the form and matter they study, i.e., by the formal objects (subject matters) and kinds of material objects they study. “Design” qua design is not an object of study of any of the natural sciences. Intelligent Design’s attempts to expand the natural sciences to incorporate design should be rejected on its face, just like philosophy cannot absorb the objects studied by, say, physics.

    “Design,” in its widest throw, is a combination of formal causality (if actualized) and final causality (if the exemplar cause exists in the mind of the designer). Design is a concept in the mind of the designer or is instantiated in a real being or both. Neither the formal nor the final cause is per se accessible to the modern empirical sciences, yet they are presupposed for science to do its work.

    “Design” is no more a directly-accessible proper object (subject matter) of the modern empirical sciences than life is an object of direct study by the biological sciences. The modern empirical sciences study objects directly (or via instrumentation) observable by the five external senses, e.g., biology studies living things—not “life,” except in an indirect, analogous way.

    Rigorously and formally stated, the only possible argument for the existence of “design” (arising from a contingent rational agent-designer) is a philosophical one. However, humans naturally philosophize all the time: the important question (channeling Feser) is whether a person philosophizes well or poorly. One can no more deny a philosophical component or presupposition to SETI, forensic crime-scene reconstruction, or anthropology than one can appeal directly to the natural sciences to infer design.

    (Philosophy doesn’t need to “compete” with the natural sciences… except for the chowder heads at Edge.org. Scientism–weak or strong–IS a philosophical, not MES, notion… and hence self-refuting. Rosenberg (sorry, Tom, but it’s got to be said) is a fame-chasing, self-serving fool… although it recently seems to be dawning on him that he needs much more robust arguments to even dream of possibly promulgating his trash.)

    As a consequence, the notion of “inference to design” directly by means of the modern empirical sciences is a non-starter. The natural sciences are “not equipped”—nor should they be—to handle properly philosophical concepts. One can infer directly to the existence of a neutrino—a material object—by means of physics from observed apparent violations in conservation laws. One cannot infer directly to design from physical observations alone without passing through philosophical reflection.

    Just as with ultimate and proximate causes, there is a great difference between “design” understood as somehow referring to God and the “design” behind human artifacts. To deny design—proximately (in artifacts) or ultimately (in Creation) is to be either in deep denial or out of touch with reality. However, reasoning to the existence of design cannot occur through—only from—findings of the modern empirical sciences or general observations of nature.

    God does not “make” anything… otherwise, He would be reduced to something akin to Plato’s Demiurge artificer. As Actus Purus He creates, which is an atemporal divine act that brings into existence “from” (ugh! I hate the word) non-existence (i.e., “from” nothing… stupidity of Krauss et all notwithstanding) and maintains all contingent beings in existence. Atemporal acts are utterly inaccessible to the natural sciences, which require a “before” and “after” state (i.e., change) to study material objects and physical phenomena, and time is the metric of change.

    Of course, God can and does interact in His Creation, and such events are properly called miracles. God’s Providence (perhaps, at times, too crudely referred to as “guidance”… which is Plantinga’s sloppiness) is not only expressed as a creative atemporal act that maintains contingent beings in existence. God also invests created beings with capacities or powers to act as secondary causes within the bounds of their own natures. The efficient and final causes of natural things are never in conflict.

    Finally: DavidP… please don’t tempt me… you’ve written some pretty questionable (and I’m being VERY diplomatic) things in commenting on this blog. And, Ray Ingles is among the top contenders for self-serving idiocy that then falsely whimpers “why don’t you show me how I’m wrong.”

    Wherein, I exit…

  62. @Ray
    I did supply a definition of CSI in my analysis, at least conceptually what I meant:

    There is a component to living systems that is not present in non-living systems, namely complex specified information (codes, algorithms and programs – software that controls and directs how living systems function) + the infrastructure upon which that software executes – the ‘hardware

    Perhaps I should not have used the CSI phrase, given that it has ID connotations that I was not necessarily espousing.

  63. I’ve been on the road all day. Big family celebration tomorrow. I won’t be that involved in comments over the weekend. But there’s always something of interest. Ray, you wrote,

    The interesting thing is that the set of ‘things we can account for without recourse to the supernatural’ has been growing monotonically since we started keeping records. It’s never gone down. I know of no case where something that people generally agreed was a simple, non-supernatural phenomenon later became regarded as a ‘contrary to nature miracle’, or even ‘beside nature’ (to use G. Rodrigues’ terminology, however much that might pain him). But I can point out lots of cases of the opposite.

    And you conclude that that means the most likely outcome is that we’ll eventually have non-supernatural accounts of everything.

    But this is an unwarranted extrapolation for several reasons.

    First, it supposes that success is measured by growth in knowledge. That’s a strange measure of success, for it requires ignorance at every stage. If there were some field in which knowledge was essentially complete, then that field would fail your test.

    Second, it assumes that if there were supernatural entities, they should be as easily accessible and tractable to research as natural ones. But there is no reason to assume that, especially if some supernatural entity(ies) is/are either (a) personal: for persons are not as readily researched as non-persons; or (b) the creator and sustainer of all that exists, for such a creator could never be tested for from “outside the system,” as it were (there is no control); or (c) uninterested in making itself/himself the subject of experimentation; and/or (d) interested in leaving some doxastic choice to humans, such that there is room to believe or disbelieve in him, especially if there were some relational or moral component there.

    All of these describe the Christian view of reality.

    So this is the conclusion: you have disproved all the views of supernatural reality except for those that feature (a) through (e) at least. Congratulations: you have disproved non-Christianity. Thank you, and may we use that argument in our own apologetic interactions with neopagans and pantheists?

    But this is what you’ll do: you’ll take that information and ignore it, and someday you’ll trot out the same refuted argument again — unless you’re willing to learn from processes like these.

    Are you?

  64. Holo,

    Thank you for all you have contributed here. It saddens me that you won’t, at least occasionally, contribute again. I hope all is well with you and wish you all the best.

  65. Holo, I think I followed this philosophical view up to the point you said, “Of course, God can and does interact in His creation”. This appears to say that God can enter His creation and perform (temporal) acts within it. I’m unclear why this qualifies as an “of course” kind of a statement. What is your thinking behind it? Also, does it not open a (metaphorical) door for natural sciences to gain access to Him?

  66. No.

    Actus Purus means an utter privation of potency in the sense of full “unlimited” perfection which is the unchanging (hence atemporal) primal source of all change as utterly, absolutely simple.

    You are illicitly and univocally extending “interact” in the physical sense (hence the univocity) to the Primary Uncaused Cause: God is not a cause among causes or a being among beings. He “causes” simply because He IS (I AM that I AM – Exodus 3:14). To think otherwise is to “domesticate” Him (per Platcher). He is Existence Itself: His Essence is His Existence (contra Craig’s univocal silliness and near heresey). No contingent being’s essence is to necessarily exist (we know who George Washington is/was without him being here among us), while God IS the Necessary Being. God “interacts” simply by BEING: as unbounded perfection, all contingent beings are drawn to him–literally–through love. As a very distant example: my wife radically changed me–moved me–without herself batting an eyelash: I started “orbiting” her simply because she is… she moved me without herself “moving”.

    That’s all I can say in sound-bite mode: there are hundreds of years of reflections and entire books written on Divine Causality, which presuppose serious philosophical preparation. This is not sound-bite reducible stuff in the sense that atheists want simple-minded “proofs”. If there is one unassailably categorical thing I can say about atheists: they are ignorant, and those who are intentionally so want everything reduced to a cowardly scientistic sound-bite to fulfill some preconceived notions or emotional needs.

    It’s kind of like trying to explain to a freshman why a mathematical Hilbert space is infinitely dimensional to accommodate a descriptive efficacy of all possible vibrational states of a particle: it’s the mathematical formalism (a being of reason) that is of infinite dimensions–NOT the particle as a real thing itself. The mathematics can only describe a narrow aspect of the real being. That’s similar to what atheists want (metaphorically speaking): they want God to fit within their descriptive bounds… and if He doesn’t, then for them He indeed doesn’t exist. The irony is, they’re correct: He doesn’t “exist” within their personal bounds. They’ve “proven” something other than the God of Abraham, Isaac, and Jacob doesn’t exist (Tom’s point above). Good for them… but do they want a medal, or a chest upon which to pin it? The sad not-so-funny joke (at their own hands) is upon them.

    Still trying to exist…

  67. I understand that you have read and thought on this topic for a long time and it’s not easy to boil it down. I am simply trying to understand what you are saying. I am not trying to “domesticate” Him. In fact, that is why I asked the question about miracles because it seemed to me to contradict this atemporal concept of God.

    Are you implying that you do not believe that God took physical form as Jesus and performed acts within our temporal world of cause-and-effect. Are you saying that he only moves people emotionally (and then to action) through their belief?

    Are you also implying that you do not believe that emotions and relationships (e.g. between you and your wife) can be studied scientifically?

  68. Your puerile response is exactly one of the reasons I’m bowing out. “moves people emotionally”?!? Sheesh! You want a god on your terms: be my guest.

  69. I’m trying to understand your view. Stay calm please and help me understand.

    Do you believe that Jesus walked the Earth and Jesus is God?

  70. The answer is yes, Holopupenko does believe Jesus is the’Incarnate Deity’ – the 2nd Person of the Trinity, who as John says so perfectly ‘the Word became flesh and dwelt among us’ (John 1:1-5 and John 1:14-18). Paul picks up on this in his letter to then Colossians 1:15-20 – the ‘He’ being referred to comes from Colossians 1:13-14 – namely God’s beloved Son, Jesus Christ.

    John also later writes in one of his short letters (1 John 1:1-3) that he is testifying about what ‘we have seen with our eyes, what we have looked at and touched with our hands (an allusion to Thomas’ confession of faith after seeing Jesus alive in John 20:25-29, among others)’.

    Yes, this is what we believe and affirm as Christians: that the 2nd Person of the Trinity took on the nature of a man in the person of Jesus of Nazareth, and that He possesses both natures (fully God and fully human) in one person, and still does now (1 Corinthians 15 among other NT discussions of Who Jesus is).

    While He was on earth, Jesus could ‘interact’ with His creation as we, being only human, are constrained to do so; being also God, He could ‘interact’ with His creation as God does (and as Holo has explained above). Thus He could perform miracles in the power and manner of God. To us, these would still appear as discontinuities in the normal stream of cause and effect, as nature left to itself would never have worked in those particular ways.

    This is why, in John 2:1-11, John presents the turning of water into wine as a miraculous event – he knew full well that water does not spontaneously become wine in such a manner – this is not the normal way nature works, hence it is not a natural process. Science can only describe natural processes and events (because only these are describable in terms of the properties and dynamics of a system and its constituents), becausen we must interact with the system using natural processes (that our senses are designed to use) ourselves in order to observe and test. John (and the servants) knew the initial state of contents of the ceremonial jars (John 2: 6-7), and the final state (John 2:9-10)

  71. Thank you for answering on behalf of Holopupenko. I don’t think you’re right about his beliefs. He may have once believed that, but his statements above seem to contradict this.

    I personally think the reason he’s pulling out of this conversation (and this site) is that his beliefs have altered to the extent that he cannot in all honesty argue for the word of the Bible, though perhaps he does not wish to admit it.

    His view appears to be: God doesn’t exist; God is existence itself.

  72. Do you understand what the Hebrew ‘YHWH’ represents and implies (Exodus 3:14)?

    Go and study the Christian thinking on this topic down through the ages, and perhaps you might gain some insight and understanding of what it signifies.

  73. DavidP:

    My frustration lies in the fact that you bandy about terms in only one way or sense. Moreover, it’s impossible to even attempt a response to your immediately previous question without you understanding (although I’m not demanding acceptance) of what the word “nature” means (not to mention essence, formal cause, and substance). Why? Because Christ “had” two natures while on earth: one human, one divine… an impossibility for contingent (created) things. (And, what leads you to the incorrect–implied–conclusion that because God is atemporal that he must become temporal in our world to act? Which, btw, is why it’s important to understand the term “nature”.)

    Some things are “mysteries” (not in the dime-store sense) in the Christian faith, i.e., they are unassailable by human reason and hence we MUST depend on revealed knowledge (e.g., the Incarnation, the three persons of the Trinity, etc.; other things are knowable fully within the light of human reason (like the existence of God as one of the preambula fidei). And, I wretch inside as I write this as a reaction to Boghossian’s nonsense.

    I don’t have the time or inclination or patience to lead a course on metaphysics, the philosophy of nature, or natural theology here because, for among other reasons, it would high jack Tom’s blog. You should take that not as an evasion but as an invitation to spend the time actually doing some long-term philosophical heavy lifting. You should take Shakespeare’s admonition seriously: “There are more things in heaven and earth, [DavidP], than are dreamt of in your philosophy. ” Just because something is difficult to explain because it demands so much prior preparation doesn’t mean a puerile application of Ockham’s razor supposedly resolves all issues. Do you want to understand quantum mechanics as a physicist does (and I’m not even talking about imposing philosophical interpretations)? Then you must have under your belt mathematics up to an including complex variables, linear algebra, and differential equations; you must have advanced classical mechanics and electricity and magnetism: that’s at least several years of study. If you want to understand just one book of Thomas Aquinas (the Summa Theologiae), you must know COLD the following before diving in: all of Plato, all of Aristotle, all of Scripture, all of Augustine and Plotinus, all of the Church Fathers, Peter Lombard… ALL of these are presupposed.

    If you think you can get away with sound-bite MES-only explanations, then we must part ways. If not, enroll in a philosophy program and beef up WELL on the modern empirical sciences. Maybe then you’ll see that these disciplines speak different, albeit complementary, languages… and that truth never contradicts truth.

  74. @82: I’ll ignore the childish and baseless insinuations in the first two paragraphs. The third is correct, to wit, “God doesn’t exist; God is [E]xistence [I]tself.” It IS technically incorrect to assert God exists because you’d be tacking existence on as just another property… Sorry, but you have a LONG way to go just to understand what we’re saying. Acceding to it or accepting it is then left wholly to you.

  75. And, by the way, just to make sure I’m not misunderstood, one does not need to be a pedantic academic to have faith: faith is, as Tom mentioned, trust. As a Christian, I’m always wanting to know more about my faith and in particular about God as Trinity… as the Lover teasing me to chase Him. That’s St. Anselm’s formulation: “faith seeking understanding.” Faith opens your heart, reason opens your mind… and the two are inseparable. You, DavidP, seem to want understanding without faith… or the Cross without Christ. You don’t want to be child-like… you want to be childish.

  76. Holo, Thank you for expanding on this. I take your point about the platform of understanding required to understand quantum mechanics. Though, in my experience, stupid questions, from the relatively ignorant, occasionally end up not being so stupid after all. Sometimes you can go too deep and lose sight of the big picture. I also think that if you can’t explain your view in simple words, you probably don’t understand it yourself. That’s my belief.

    When you say that to understand God I need faith as well as reason it seems to beg the question. But I do think that there is truth in the idea that we see what we look for.

  77. In order to understand God, you need to be in a relationship with Him (you still don’t grasp the nature of faith as Biblical Christianity defines it). That is a personal decision and an act of personal commitment. It is also something that God the Holy Spirit gives to anyone who is willing to act on what he or she has heard about Jesus Christ, particularly about His death and resurrection ( Romans 4:23-5:8 and Romans 10:9-11 for example ). That’s only the first step – when a person does that, he or she enters into that relationship with the Triune God, by the 3rd Person of the Trinity, God the Holy Spirit, taking up residence within us and beginning the process of transforming us and teaching us ( see 1 Corinthians 1:18-2:16 for one of Paul’s discussions on the latter, and Galatians 5:17-25 on the former).

    Reason will get you to think about the objective information about Jesus Christ, but it is the Spirit of God Who will convince you of the truth and convict you of your need for repentance in the light of God’s sovereign and inevitable justice.

  78. Nicely explained! I find this a useful insight into how religions infiltrate and then take over a person’s thinking.

  79. Do you think anyone will take you seriously or want to engage you, DavidP, for saying something that stupid to Victoria? You’ve just revealed in dazzling colors that you’re not here to learn by asking questions: you’re asking questions to serve your own personal presuppositions and emotional needs. That’s why, in the just-revealed context, your questions ARE, indeed, stupid… because they carry an agenda not connected to seeking truth. Why seek truth when stupidity works just fine? I’m outta here…

    Aristophanes: “Youth ages, immaturity is outgrown, ignorance can be educated, and drunkenness sobered… but stupid lasts forever.”

  80. In order to understand God, you need to be in a relationship with Him (you still don’t grasp the nature of faith as Biblical Christianity defines it).

    Yes, God cannot be known objectively. It just isn’t possible.

  81. David P,

    You may want to look up the difference between univocal, equivocal and analogical language as they pertain to God, as a start to see where you are going wrong. That is if you are seeking understanding, rather than just looking to reinforce your prejudices …

  82. BillT –

    What a crock. When I said “I can accept that in principal.” what did you think that meant.

    When you added the “However…” part, I assumed you were saying you don’t accept it in practice. And you were pointing out a case where you believe we can go from “hasn’t” to “can’t”. I confess I can grasp what the point of your objection was, if you meant something else.

    And you had no reason to think I wasn’t aware of the “hypotheses” you mentioned as they weren’t part of the discussion.

    Since you said ” the origin of life folks don’t even have a legitimate starting point”, and I’ve seen several, I can only conclude you haven’t really looked into them.

  83. Victoria –

    Do you have a rigorous definition for the information content of the .NET runtime system? Or any piece of complex software?

    I think Holopupenko has addressed most of that. In terms of the .NET runtime system, it can be rigorously measured in Shannon terms, or a rigorous upper bound can be determined in Komologrov complexity terms. (If you want to see “the acerbic Shallit” contrast that with “complex specified information”, see here.)

    I did supply a definition of CSI in my analysis, at least conceptually what I meant:

    I still don’t get it, then, since computers contain hardware and software, yet so far as I can tell you would contend they are not living. (Please correct me if I’m wrong there.) So there must be something else yet that differentiates them. I assume it’s not just that computers tend to be made of silicon and living things are made of big carbon-based molecules…

  84. Tom Gilson –

    First, it supposes that success is measured by growth in knowledge. That’s a strange measure of success, for it requires ignorance at every stage. If there were some field in which knowledge was essentially complete, then that field would fail your test.

    Um… I never said anything in this thread about ‘success’. The first time anyone in this thread even used the word ‘success’ is when you did, just now.

    I’d be happy to grant that progress in a field of knowledge depends on ignorance, but that’s not the same thing as ‘success’. I honestly don’t grasp what the heck you’re talking about, here.

    Second, it assumes that if there were supernatural entities, they should be as easily accessible and tractable to research as natural ones.

    That’s not required. We keep coming up with better and better ways to study more complicated and intractable phenomena. I can assume that that trend will continue, too. That addresses (a). As to (b), if It’s a Deist “creator and sustainer” then it’s by definition non-interacting, and so I fail to see a practical reason to worry about It. If It interacts, then by definition it affects reality.

    It can certainly keep Its interactions below the level of detectability if It chooses, I suppose (c and d). In which case, though, we’ll still eventually get to a naturalistic account that works for everything we can detect, right?

    Congratulations: you have disproved non-Christianity. Thank you, and may we use that argument in our own apologetic interactions with neopagans and pantheists?

    Correction: So far as I can tell, the odds are against (not “disproved”) non-Christian theisms, not everything that isn’t Christianity. And if Christianity is true, then it won’t affect our ability to keep finding more and more naturalistic accounts for things. But yes, feel free to use whatever you find useful there.

    Note that I’m not claiming to disprove Christianity here. That’s where you (and Victoria with “You still have to show that the Christian explanation is not the inference to the best explanation for these historical and experiential claims” bit) go wrong. I’m not trying to argue against Christianity in this thread. I’m just pointing out problems with a particular argument for theism. And I’ve even noted that it’s far more often used by New Age types than Christians!

    I still think BillT’s an example of a Christian using it, though for the reasons stated in #94.

  85. Ray, I consider progress successful. Quibble on if you must, but realize it’s a bore, okay? My statement works if you substitute “progress” for “success.”

    I don’t think you understand what tractability means in this context. And no, I don’t think we’ll ever get to a naturalistic account of everything we can detect. The universe, the existence of life rather than non-life, your free decision-making as to what you will write on this blog — only one of these is tractable to natural accounts even in principle, for logical reasons.

    Your “correction” is needless quibbling as well. You know darn well what I meant.

    Yawn.

  86. @Ray re#95
    1. Yes, Shannon information can be measured and quantified, so you can quantify the number of bits of information in a given piece of software – how do you quantify the functionality? Imagine two bit sequences of length N-bits. What is it that makes the first sequence a piece of software that can recognize and categorize features in an image, and the second sequence something that does nothing whatsoever?

    2. We happen to know how computers are built – they were designed and implemented by intelligent agents (although to look at some code out there makes you wonder, eh? 🙂 ). We have used Solid State Physics and Electronics to build a hierarchical structure ( logic gates, and then boolean algebraic functional units), CPU’s with units that implement its instruction set, etc) upon which we could impose codes and programs that we ourselves have designed, ultimately to implement algorithms and functions that are not remotely related to solid state physics, electronic circuits, boolean algebra, or even the CPU instruction set.
    Citing evolutionary algorithms and programs like Avida( I downloaded that to my system, BTW, so that I could play with it more detail when I get a chance 🙂 ) doesn’t count, because even those programs were designed and implemented by intelligent agents, on computer hardware that we designed. In the analogous case of living systems, where did the hardware come from, where did the codes come from in the first place? Are unguided natural processes sufficient to account for that?

  87. @Ray
    My point about this

    Note that I’m not claiming to disprove Christianity here. That’s where you (and Victoria with “You still have to show that the Christian explanation is not the inference to the best explanation for these historical and experiential claims” bit) go wrong. I’m not trying to argue against Christianity in this thread. I’m just pointing out problems with a particular argument for theism.

    is that we still have to distinguish between my cases {(a) or (b)} and { (c) or (d)}, regardless of what the MES’s have to say about the natural world.

    It seems to me that many sceptics of Christianity (in particular) are so busy trying to dismiss and discard individual pieces of the puzzle that they completely miss that if they assemble the puzzle pieces, a real picture emerges.

  88. Reality isn’t static. Things have changed since that picture was put together. The world and our knowledge have moved on. We can make our own pictures that build on that knowledge and better represent our current reality.

    Christianity helped fill a natural desire for answers. Now we have more reliable ways to get answers to questions.

  89. Things have indeed changed.

    People no longer have genuine spiritual needs. They no longer need explanations for moral truths. The universe’s existence no longer needs explaining; in fact, since reality isn’t static, it’s quite possible that several years ago the universe had a beginning, and now it now longer had one.* People used to have this mysterious thing called free will but since reality isn’t static, it’s gone. It left. I’m not sure where it went, but it fled the coop, and we had (ahem) no choice about it. Same with consciousness: were you not aware of that?

    No one cares about all that information about Jesus’ life, death, and resurrection: it hardly matters, since no one cares about life, death, or resurrection these days. Richard Dawkins dismissed Thomas Aquinas’s Five Ways quite handily in a paragraph. Design in biology is easily set aside by ignoring it.

    The world and our knowledge have moved on.

    I’ll be shutting down this blog in an hour or two.

    *I’m not totally sure of the grammar there 😉 .

  90. Did you not notice? I shut it down already.

    If that seems contradictory, well, the world and our knowledge of it just ain’t what they used to be.

  91. But the current comment problem you may or may not be experiencing on certain browsers has nothing to do with that. Purely coincidental. Just close your browser and reopen it, and the world will be back to the way you’ve always expected it to be.

  92. Due to RL time restrictions I’ve been lurking more than commenting lately, but I wanted to thank Holo for his contributions.

    “As a Christian, I’m always wanting to know more about my faith and in particular about God as Trinity… as the Lover teasing me to chase Him.”

    Reminds me a bit of Rumi. I feel like the closest I’ve ever come to understanding God on a personal level has been when I’ve read Rumi. Very moving for me.

    “Faith opens your heart, reason opens your mind… and the two are inseparable. You, DavidP, seem to want understanding without faith… or the Cross without Christ. You don’t want to be child-like… you want to be childish.”

    These words challenge me, and they are difficult to grasp because they represent something very unnatural to me (e.g. I don’t need to trust gravity for it to work). They would not have sunk in if it wasn’t for the Rumi-esque reference a few sentences earlier. I will contemplate them, but I don’t know if I will understand them any time soon.

    Anyways, thank you for that. I appreciate the time that you spend here, and the reminder that I’m still grasping at the edges of knowledge.

  93. Holopupenko –

    Ray Ingles is among the top contenders for self-serving idiocy that then falsely whimpers “why don’t you show me how I’m wrong.”

    Since I’m not aware of a single example of you ever even attempting to instruct me on anything, I’m puzzled why you would claim my question is ‘false’. But that same history gives me no reason to expect an explanation on that either, I suppose.

  94. Tom Gilson –

    Ray, I consider progress successful.

    Progress towards success? “Success” implies some kind of completion. Progress in knowledge requires ignorance, success does not. It’s true that “[your] statement works if you substitute “progress” for “success””, but then it’s saying something rather different, and not terribly relevant.

    And no, I don’t think we’ll ever get to a naturalistic account of everything we can detect.

    I understand you have a different opinion from mine on that, sure. (Be careful you don’t fall into what Dennett calls ‘The Philosophers Syndrome” – mistaking a failure of imagination for an insight into necessity.)

    You know darn well what I meant.

    If I’m as thick as y’all claim, maybe I didn’t. Care to elaborate?

  95. Thank you for that philosophy lesson, Ray. I will be very careful to avoid that error. I think I have been, actually.

    While we’re at it, what do you think of Boghossian’s errors?

    And no, I don’t care to elaborate.

  96. @Sault
    Hi Sault – nice to see that you are still with us 🙂 I trust that all is well with you and your family. Take care.
    V

  97. Victoria –

    how do you quantify the functionality?

    As Holopupenko laboriously pointed out, that’s not quantifiable. Of course, I didn’t claim it was, nor does anything I’ve said depend on that being quantifiable.

    Citing evolutionary algorithms and programs like Avida… doesn’t count, because even those programs were designed and implemented by intelligent agents, on computer hardware that we designed.

    The environments that the evolving programs run in were designed, true. The actual programs themselves, no. Just because we grow cell cultures in a petri dish doesn’t mean it’s impossible for cells to grow in the wild.

    In the analogous case of living systems, where did the hardware come from, where did the codes come from in the first place?

    Well, the current hypotheses propose very little differentiation between ‘hardware’ and ‘software’. RNA can act both as a ‘data-storage medium’ and as an ‘enzyme’. (I talked a bit about that above. More here, seek out “March 22nd, 2012 | 3:33 pm”; can’t link directly to comments there.) The earliest forms would be self-catalyzing chemicals. Once that got started, differentiation and specialization could gradually arise.

    Are unguided natural processes sufficient to account for that?

    We dunno yet, but I find the work to date suggestive.

  98. @Ray re #114

    The environments that the evolving programs run in were designed, true. The actual programs themselves, no. Just because we grow cell cultures in a petri dish doesn’t mean it’s impossible for cells to grow in the wild.

    That sounds more like side-stepping the core issue, namely is the environment in which living systems operate designed or not?
    However, given the runtime environment, self-adapting programs that can arrive at some function not originally present (like the Equality operation in Avida) are not out of the question.

    (a) even the equality operation in Avida was specified as a target function, since the solution filter gave that function the highest reward value.
    (b) the equality function is expressible in terms of the basic instruction set of that particular Avida exercise.
    (c) what about programming a simulation to produce the two’s complement addition function using that same basic instruction set? It can’t be done without introducing a bit shift instruction (which was not part of the original boolean logic set).
    (d) How do Avida programs scale with ‘genome size’? It is one thing to simulate evolution with a few 10’s or 100’s or 1000’s of bits, but what happens when the size grows to Gigabits or Terabits worth?

    I’m still on the fence between Programmed Evolution (my Theism 1 universe) and Directed Evolution (my Theism II universe) as God’s means of bringing about His created order. Perhaps the MES’s will give us an answer, perhaps not, but I don’t subscribe to promissory naturalism the way you do.

    Side note: a book you may find interesting: Mapping the Origins Debate by Gerald Rau.

  99. Tom Gilson –

    While we’re at it, what do you think of Boghossian’s errors?

    I already commented on the one I found interesting. I’d never heard of him before you mentioned him here; overall, I think he’s about as good a representative of atheism as Joel Osteen is of Christianity.

    And no, I don’t care to elaborate.

    Guess I’ll just have to remain unenlightened by you, G. Rodrigues, and Holopupenko. Oh, well.

  100. BillT –

    Just more prevarications.

    I’m not lying. That’s really how I interpret your words.

    You could clear that up, though. You could say something like, ‘No, I don’t believe that it’s reasonable to conclude that science can’t explain the origin of life simply because it hasn’t yet.’ I’m puzzled why you haven’t, if you don’t think that. I think your words have very reasonably given that impression so far.

  101. Victoria –

    That sounds more like side-stepping the core issue, namely is the environment in which living systems operate designed or not?

    That is, indeed, the question. But first you have to establish that environments exist where “self-adapting programs [] can arrive at some function not originally present”. That’s a necessary first step. Simulations like Tierra and Avida act as an existence proof for such environments.

    The next step, of course, is to determine if Earth (or, more specifically, Earth four billion years ago) contained such environments. Then, to determine if such environments could arise without intelligent intervention. Note, though, that the questions in practice aren’t quite as logically separable as that, and what we learn addressing one of them can shed light on the other.

    what about programming a simulation to produce the two’s complement addition function using that same basic instruction set? It can’t be done without introducing a bit shift instruction (which was not part of the original boolean logic set).

    Actually, Avida does contain two bit-shifting instructions. Of course, Avida is Turing-complete, so a bit-shift function could be implemented in Avida. Whether it could evolve is another question – being actively researched.

    …I don’t subscribe to promissory naturalism the way you do.

    I’m not sure I subscribe to “promissory naturalism the way you [think I] do.” Having played with evolutionary algorithms myself, they seem the most likely bet, but that doesn’t mean I claim to know or anything.

  102. @Ray
    Ah, thank you for the clarification on the instruction set 🙂 The original article I was reading about the evolution of the equality operation didn’t mention that the base set included shifts, so it was my faulty assumption that they weren’t included at all.

    I think we agree on what you said in #118.
    We might also have to add (for completeness) that living systems’ information storage and processing systems would have to be completely analogous to the simulated ones. Are you aware of any rigorous ‘proof’ in the mathematical or algorithmic sense for that premise?

    Sidebar:
    Yes, with bit shifts, it is possible to construct an algorithm to perform two’s complement addition in Avida, of course. It would be interesting to see what algorithm Avida might produce ( would it produce a for loop construct with an exit condition, or would it produce a long sequence of steps). Since I have the system, I could give it a try.

  103. Ray,

    Re: Yr #117

    I have explained my position any number of times, detail by detail, statement by statement. I have not only demonstrated and denied yours was the proper interpretation but further showed how it was in line with the exceptions Tom offered. I can do it all again, maybe this time while I stand on my head spitting wooden nickles, but I doubt it would change your mind.

  104. @Ray
    The base instruction set also includes 2’s complement addition and subtraction and not-equal. It’d be interesting to see if really high order algorithms could be evolved (like floating point operations)

  105. It seems to me, the points and reasons for faith that Boghossian lists, are not necessarily the ones used by trained apologetics.

    However, it could be his opinion that they are the ones that most commonly come up in discussions with ordinary Christians.

    This doesn’t mean they are the true definition of faith, merely that they are the ones he hears most frequently.

  106. That’s right, Robin, and it defines the situation nicely.

    If you read the rest of the series, you’ll find that he takes the worst possible form of the “ordinary Christian” definition of faith to be the only allowable definition. No other view of faith is permitted. Yes, he states it that plainly and definitively.

    By his reasoning, the only way we can conceive of faith is in the manner of those who haven’t given it much thought, and who in fact have not acquired the ability to articulate what faith really is. If some people actually have given it some thought, and if their informed and reflective view differs from the view of those who haven’t thought much about it, it is the less informed, less reflective, and (in the end) false view that defines faith, according to Boghossian.

    The point of my article was that the unreflective and less informed view of faith really is vulnerable to a Boghossian-style series of questions. That’s why McDowell, Kunkle, and others use those kinds of questions: to help believer see they need to think through their faith more deeply and with more information at hand.